Team:TPHS SanDiego/Journal

From 2013hs.igem.org

(Difference between revisions)
 
(14 intermediate revisions not shown)
Line 7: Line 7:
<map name="igemmap">
<map name="igemmap">
-
   <area  shape="circle" coords="480,40,40" alt="Mercury" href="https://2011.igem.org" onfocus="this.blur()" />
+
   <area  shape="circle" coords="480,40,40" alt="Mercury" href="https://2013hs.igem.org" onfocus="this.blur()" />
</map>
</map>
Line 37: Line 37:
<div class="row">
<div class="row">
-
<div class="col12"> <img src="https://static.igem.org/mediawiki/2011/c/c1/NotebookSubHeader.jpg" width="980"> </div>
+
<div class="col12"> <img src="https://static.igem.org/mediawiki/2013hs/a/a0/Journals-Daily-Bar.jpg" width="980"> </div>
<div class="row-end" ></div>
<div class="row-end" ></div>
</div>
</div>
Line 46: Line 46:
<div class="row-end"> </div>
<div class="row-end"> </div>
</div>
</div>
-
<p>
 
-
    Daily Journal
 
-
6 June 2013:
 
-
1 June 2013: The ligation adding the modified promoters into the vector Btp002 didn't work. We've tried to grow them up in overnights to mini-prep and sequence twice now and we haven't gotten any cells to grow. We'll have to redo this step on Monday and since it requires gel extractions, people will have to come into our lab.
 
-
31 May 2013:  This weekend's transformations looked successful, but we still have no idea if they are right.
 
-
To recap: We did digestions on 9145-Btp002 (BglII/XbaI double digests) and the 5 wobble products that are our 5 different promoters. We then ligated those after gel purification and transformed them into Dh5a.
 
-
However, we don't even know if the 9145-Btp002 vector we used is good, because we can't do sequencing on the weekend. We sent 9145-Btp002 clones 1-4 in for sequencing today, so hopefully clone 3 will be a positive match because that is what we used for our digest/ligations.
 
-
So, tomorrow: check sequencing on 9145-Btp002 clone 1-4 (Sequence in Dropbox folder shared team). If clone 3 is a match then proceed to Route 1. If clone 3 isn't a match but a different one is, then proceed to Route 2. If none are a match then proceed to Route 3. (Pray that we don't have to take Route 3).
+
<div class="row">
 +
  <div class="col12-2" >
-
Route 1:
+
<div align="justify">
-
I assumed our ligations went well and we have product, so I picked 2 colonies each from the 5 different constructs we (potentially) made 9145-Btp003 - Btp007 and have put them in LB-Amp to grow overnight. You can find those in the second shaker in my 24-well block thing, and their sequences in the dropbox I shared with all of you.
+
<p>
-
TODO Wednesday:
+
&nbsp;
-
Check Sequencing of Btp002
+
&nbsp;
-
Mini-Prep 9145-Btp003 - 9145-Btp007. Also make -80 stocks.
+
&nbsp;
-
Send each in for sequencing with the primer ca998 which has been left on my desk in my blue tube rack.
+
-
ca998 sequence: gtatcacgaggcagaatttcag
+
-
 
+
-
TODO Thursday:
+
-
check sequencing. Keep -80 stocks if they match.
+
-
If all don't work. I'll have to let you know what to do from there depending on what the sequencing looks like.
+
-
Likely, I will have you design forward colony PCR primers that can read from inside the specific promoters over to g00101 (a region conserved in all 9145 plasmids, marked in purple on ApE, and is a reverse primer used for sequencing and col PCR). If this is the case, the plates with the colonies are marked with white tape with red zig zags on it. Do some colony PCR.
+
-
If any subset works, continue on with characterizing those.
+
-
TODO Friday:
+
-
Transform 6 constructs (ideally): 9145-Btp002 -9145-Btp007 into LanRFP comp cells. John should know where these are.
+
-
Plate on LB-Amp-Cm plates (might have to make these)
+
-
TODO Saturday:
+
-
Pick into LB-Amp-Cm
+
-
TODO Sunday:
+
-
Re-seed into (+/-) LasR-specific AHL, LB-Amp-Cm media.
+
-
TODO Monday:
+
-
Measure in plate reader.
+
-
 
+
-
Route 2:
+
-
If Clone 3 isn't right, but a different one is: If Clone 1 happens to be right then we already have the digested gel-purified vector which is in Scott Box 3 labeled "Btp002-1-XbaI/BglII" if its 2 or 4, then those need to be digested with XbaI/BglII and gel purified. They are on my blue tube rack.
+
-
 
+
-
TODO Wednesday:
+
-
Get correct Btp002 to digested & gel purified state
+
-
Ligate with all 5 promoters (separately)
+
-
      4.3ul Vector, 4.3ul promoter isnert, 1ul T4 buffer, 1ulT4 enzyme.
+
-
Transform into DH5a
+
-
TODO Thursday:
+
-
Pick into LB-AMP, grow overnight
+
-
TODO Friday:
+
-
Start at Route 1 Day 1 (mini-prep, make -80 stocks)
+
-
 
+
-
Route 3:
+
-
Everybody have a 15-minute pity party. I don't understand how this would be the case, since all 4 of these were colony PCR hits, and 1 & 3 mapped well. 4 was iffy.
+
-
 
+
-
In this case, do colony PCR with ca998 and g00101 on colonies from the CPEC plates that I have wrapped in white tape marked with Green zig zags. If successful the bands should be around 2k. (just look at the 9145-Btp002 plasmid)
+
-
 
+
-
Grow the overnights, mini-prep, sequence.
+
-
 
+
-
Hypothesis: This is what we are expecting from the (+/-) AHL assay whenever we get there:
+
</p>
</p>
-
</div>
+
<center>
-
</html>
+
<iframe src="https://docs.google.com/document/d/1YAY-ZFxQy35_8JGAiW_UNIQN7XUNjLyycZazxe3UdXU/pub?embedded=true" width="875" height="875" allowfullscreen="true" mozallowfullscreen="true" webkitallowfullscreen="true"></iframe></center>

Latest revision as of 23:04, 21 June 2013

header
Mercury