Team:TPHS SanDiego

From 2013hs.igem.org

(Difference between revisions)
(→Team)
 
(205 intermediate revisions not shown)
Line 1: Line 1:
-
<!-- *** What falls between these lines is the Alert Box!  You can remove it from your pages once you have read and understood the alert *** -->
+
<html xmlns="http://www.w3.org/1999/xhtml"
 +
      xmlns:og="http://ogp.me/ns#"
 +
      xmlns:fb="https://www.facebook.com/2008/fbml">
 +
  <head>
 +
    <title>Berkeley iGEM 2011 </title>
 +
    <meta property="og:title" content="Berkeley iGEM 2011"/>
 +
    <meta property="og:type" content="university"/>
 +
    <meta property="og:description"
 +
          content="Berkeley's 2011 iGEM team wiki."/>
 +
<meta name="description" content="Berkeley iGEM 2011" />
 +
<meta name="keywords" content="igem, berkleley, 2011" />
 +
<link rel="stylesheet" href="https://2011.igem.org/Template:Team:Berkeley/nivocss?action=raw&ctype=text/css" type="text/css"/>
 +
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script>
-
<html>
+
<script type="text/javascript" src="https://2011.igem.org/Template:Team:Berkeley/javascript/javanivoslider?action=raw&ctype=text/javascript"></script>
-
<style type="text/css">
+
  </head>
-
body {background: #000000}
+
-
</style>
+
-
<a href="/Image:IGEM_Title.png" class="image" title="image page"><img alt="image page" src="https://static.igem.org/mediawiki/2013hs/8/8b/IGEM_Title.png" width="965" height="112" border="0" />
+
-
</html>
 
-
{|align="justify" background: #000000}
 
-
|You can write a background of your team here.  Give us a background of your team, the members, etc.  Or tell us more about something of your choosing.
 
-
|[[Image:TPHS_SanDiego_logo.png|200px|right|frame]]
 
-
|-
 
-
|
 
-
''Tell us more about your project.  Give us background.  Use this as the abstract of your project.  Be descriptive but concise (1-2 paragraphs)''
 
-
|[[Image:TPHS_SanDiego_team.png|right|frame|Your team picture]]
 
-
|-
 
-
|
 
-
|align="center"|[[Team:TPHS_SanDiego | Team TPHS_SanDiego]]
 
-
|}
 
-
<html><div align="right" style="margin:15px 0px 0px 0px"> <noscript> <div align="right" style="width:140px;border:1px solid #ccc; background: #040244; color: #F9F9FF;font-weight:bold;font-size:12px;"> <a style="text-decoration: none; color:#F9F9FF;" href="http://mycountdown.org/My_Countdown/My_countdown/">My Countdown </a></div> </noscript> <script type="text/javascript" src="http://mycountdown.org/countdown.php?cp3_Hex=0F0200&cp2_Hex=040244&cp1_Hex=F9F9FF&ham=0&img=&hbg=0&hfg=0&sid=0&fwdt=180&lab=1&ocd=My+Countdown&text1=IGEM High School Jamboree&text2=IGEM High School Jamboree&group=My Countdown&countdown=My Countdown&widget_number=3010&event_time=1370995200&timezone=UTC"></script> </div></html>
 
-
<!--- Team Information Link --->
 
-
{| style="color:#1b2c8a;background-color:#666666;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
 
-
!align="center"|[https://igem.org/Team.cgi?year=2013&division=high_school&team_name=TPHS_SanDiego Official Team Profile]
 
-
|}
 
-
===Team===
+
<div id="top-section3"><center><img src="https://static.igem.org/mediawiki/2013hs/3/35/TorrePinesNavigation%28Tareq%29.jpg" alt="header" border="0"  usemap="#igemmap" width="1000"></center></div>
-
Tell us about your team, your school!
+
-
We are the Torrey Pines High School Synthetic Biology Team. We are intelligent students devoted to working with bacteria and expanding our synthetic biology knowledge. Our team consists of the following people:
+
-
Tareq Younis
+
<map name="igemmap">
-
Brandon Read
+
  <area  shape="circle" coords="480,40,40" alt="Mercury" href="https://2013hs.igem.org" onfocus="this.blur()" />
-
Naim Kassira
+
</map>
-
Mokhshan Ramachandran
+
-
Michael Margolis
+
-
Gha Young Lee
+
-
Sun Myung Choi
+
-
Cindy Yang
+
-
Minh Tran
+
-
Nicki Nikkhoy
+
-
Hope Chen
+
-
The group of us are deeply interested in the general study of synthetic biology and are always looking for ways to test our knowledge and strengthen it. We are always pushing our teammates to be better. We are honored to be competing in the 2013 iGem High School Competition and are looking forward to June 12!
 
-
===Project===
+
<div class="layout-1000">
-
What are you working on this semester?
+
<div class="row">
 +
<div class="col12" >
 +
<ul class="topnav">
 +
    <li><a href="https://2013hs.igem.org/Team:TPHS_SanDiego">Home  </a></li>
 +
    <li>
 +
        <a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Project">Project</a>
 +
    </li>
 +
    <li>
 +
        <a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Parts">Parts</a>
 +
    </li>
 +
    <li><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Safety">Safety</a></li>
 +
    <li><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Team">Team</a></li>
 +
    <li><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Protocols">Protocols</a></li>
 +
    <li><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Journal">Journal</a></li>
 +
</ul>
 +
<div> <div class ="row-end"> </div>
 +
</div>
 +
</div>
 +
<div class="row">
 +
<div class="col12" id="spacer2"></div>
 +
<div class="row-end"> </div>
 +
</div>
-
===Notebook===
 
-
Daily Journal
+
<div class="row">
-
October 4 - Tareq gave us an overview of the club and information about the iGEM competition. Meetings will be every Monday after school in Mr. Belyea’s room.
+
<div class="col6" align = "justify" >
 +
<img src="https://static.igem.org/mediawiki/2013hs/4/46/ABstractBar.jpg" width="480">
 +
<p style="font-family:Georgia;color:black;font-size:14px;">In an effort to expand the toolkit available to synthetic biologists, we've taken a system natively responsible for transcriptional activation and modified it to control transcriptional repression. The LasR system from <i>Pseudomonas Aeruginosa</i> requires the presence of a small molecule, C12-3-oxo-AHL, to induce activation of the Plas promoter. By modifying the -10 and -35 sites of the promoter, as well as shifting the location of the LasR binding sites, the new Plas promoter (Plas*) was changed from an inducible to a repressible promoter. Through adding this second functionality, the Plas* promoter could be used in conjunction with a wildtype Plas promoter to control two separate genes whose expression levels are always out of sync. Furthermore, if the bacteria are transfected with a plasmid encoding LasI, the bacteria will be able to turn off gene expression at a critical population density, instead of only being able to turn on gene expression.</p>
-
October 15 - Today was our first meeting. We went over the sterilizing procedure involving passing objects over a “fire” from a lighter. We also learned how to use a micropipettor.
+
<div class ="row-end"> </div>
 +
</div>
-
October 22 - We prepared agar plates; half the plates with ampicillin mixed in and the other half without. The plates were labeled and put into the incubator.
+
<div class="row">
 +
<div class="col12" id="spacer"></div><center>
 +
<iframe width="460" height="345" src="http://www.youtube.com/embed/Ohy-y8M4j_M" frameborder="0" allowfullscreen></iframe></center>
 +
<div class="row-end"> </div>
 +
</div>
-
October 29 - We discussed the procedure for inserting the plasmid pGREEN into the E coli.
+
<div class="row">
-
November 2 - We did the pGREEN lab today with the E coli. Results will be revealed on Monday.
+
<div class="col3-2"style="background-color:#101a4d;"><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Background#TOP"> <img src="https://static.igem.org/mediawiki/2013hs/8/86/Fluob4.png"
 +
onmouseover="this.src='https://static.igem.org/mediawiki/2013hs/f/f5/Fluoafter.png'"
 +
onmouseout="this.src='https://static.igem.org/mediawiki/2013hs/8/86/Fluob4.png'" width="230"></a>
 +
<p style="font-family:Georgia;text-align:center; color:#CECECE;"> Proteins discovered in Jellyfish that have the
 +
ability to emit fluorescence.</p> </div>
-
November 5 - The results were unsatisfactory. None of the E coli. had absorbed the plasmid. The bioluminescence plasmid we had included did not cause it to glow green when we shined the ultraviolet light upon the plates. We will try again at the next meeting. Our weekly meetings have changed, and we will now meet twice a week, Monday and Friday. In addition, we looked at last year’s iGEM competition team wikis. We started to brainstorm some ideas for our project.
+
<div class="col3-2"style="background-color:#185f73;"><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Background#MIDDLE"><img src="https://static.igem.org/mediawiki/2013hs/2/2a/2pb4.png"
 +
onmouseover="this.src='https://static.igem.org/mediawiki/2013hs/1/1c/2pafter.png'"
 +
onmouseout="this.src='https://static.igem.org/mediawiki/2013hs/2/2a/2pb4.png'" width="230"> </a>
 +
<p style="font-family:Georgia;text-align:center; color:#CECECE;"> A clever way to normalize protein expression across cell populations.</p></div>
-
November 9 - Some new members came today. We taught them the basic procedures we had learned on the first day. Then, we repeated the pGREEN lab. This time we were more precise about the temperature of the heat shock and the timing of the tubes on ice. Hopefully this helps our success rate increase. Results will be revealed on Monday.
+
<div class="col3-2" style="background-color:#303285"><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Background#BOTTOM"><img src="https://static.igem.org/mediawiki/2013hs/5/5a/Lasrafter.png"
 +
onmouseover="this.src='https://static.igem.org/mediawiki/2013hs/a/aa/Lasrb4.png'"
 +
onmouseout="this.src='https://static.igem.org/mediawiki/2013hs/5/5a/Lasrafter.png'" width="230"></a>
 +
<p style="font-family:Georgia;text-align:center; color:#CECECE;"> A quorum sensing system from <i>Pseudomonas aeruginosa</i>.</p> </div>
-
November 13 - The results are satisfactory. Two groups achieved the proper results with the pGREEN plasmid absorbed into the E coli. It glows green with the ultraviolet light. Afterwards, a letter to the parents was distributed to the team to take home. We went over the procedure for inserting two genes into a plasmid using restriction enzymes and DNA ligase. We will perform the lab at the next meeting.
+
<div class="col3-2"style="background-color:#499394"><a href="https://2013hs.igem.org/Team:TPHS_SanDiego/Project"><img src="https://static.igem.org/mediawiki/2013hs/5/54/Projb4.png"
 +
onmouseover="this.src='https://static.igem.org/mediawiki/2013hs/7/74/Projafter.png'"
 +
onmouseout="this.src='https://static.igem.org/mediawiki/2013hs/5/54/Projb4.png'" width="230"></a>
 +
<p style="font-family:Georgia;text-align:center; color:#CECECE;"> Re-engineering the Plas promoter's response to LasR. <br></p></div>
 +
<div class ="row-end"> </div>
 +
</div>
-
November 16 - Meeting cancelled last minute due to our advisor being busy. Tareq informed us that there will be a mandatory parent’s meeting on Monday November 26th in the lecture hall at 6:30 PM.
+
<div class="row">
 +
<div class="col12" id="spacer"></div>
 +
<div class="row-end"> </div>
 +
</div>
-
November 26 - We carried out Lab 9, where we used restriction enzymes to cut plasmids in certain places. We were informed today that we have a mentor; Spencer Scott!
+
<br>
 +
<div class="row">
-
November 30- We met Spencer Scott, a UCSD graduate and our mentor, for the first time. Discussed possible feasibility of our proposed project. Digested and ligated pAMP and pKAN plasmids.
+
<div class="col4" align = "justify">
 +
<img src="https://static.igem.org/mediawiki/2011/b/bd/Aboutus.jpg">
 +
<p style="font-family:Georgia;color:black;font-size:14px;">
 +
We have all been brought together by a mutual interest for synthetic biology. It fascinates us how easily organisms can be tweaked and altered to our liking in this expansive field, so we thought it’d be best get started early. Through reading, lectures, mentorship and hands on experience we opened our minds and fueled our thirst for control over these malleable organisms. We functioned well together and played each other’s strengths for maximum efficiency while simultaneously having the time of our lives. We have learned much and hope to keep putting our best efforts forward till the very end.
 +
</p></div>
-
Monday December 3rd- We proceeded with Lab 3, DNA restriction analysis. We cut Lambda DNA at 9 different sites with 2 different restriction enzymes, BamHI and HindIII (pronounced like Hind), and then used gel electrophoresis to check our work. With the help of our mentor Spencer, and his colleague John, we learned how to mix and cast 0.8% agarose gel, create wells in it, properly submerge the gel in a chamber full of electrophoresis buffer, and to fill the wells with minimal error/damage to the agarose gel. John delivered two lectures, one on the properties of how enzymes denature when heated and how that relates to hydrogen bonds, and the other on how restriction enzymes work, and how we will be using them throughout the iGEM competition. In the end we were not able to analyze the results of our gel electrophoresis due to time constraints; however, we now all know the basics of gel electrophoresis. John stressed the need for a laboratory notebook, so everyone will now bring a small notebook with them for lab notes. John told us, “In science you’re going to make a lot of mistakes, but it will be meaningless if you learn nothing from them.”
+
<div class = "col14">
-
Total Time: 2 hours
+
<p>
-
Attendance: Mokhshan, Brandon, Cindy, Nicki, Michael, Tareq, Leening, Brian, Hope, Spencer, John.
+
</p>
 +
</div>
-
Friday December 7th - We decided to not focus our attention on a lab today, and instead devoted our attention to the theory behind the procedure. Spencer Scott and our additional mentor Dan lectured us about how synthetic biology is done. The basic premise of the lecture was to cover the entirety of the clone cycle, which consists of PCR (polymerase chain reaction) which will be detailed in the paragraph below, digestion (using restriction enzymes to fragment plasmids), ligation (using DNA ligase to join the digested fragments), transformation (making the E.coli take the plasmid), extraction from the E.coli itself then from the Agarose used in gel electrophoresis, and purification (isolating the specific gene that we need).
+
<div class="col8-4">
-
PCR consists of multiple cycles of three basic steps: denaturation, annealing, extension. Denaturation unzips the DNA, annealing attaches the primers to the specific part of the genome that you want, primers are things that tell the DNA polymerase (the component that makes complementary sequences for the target DNA) where to begin. Extension, the process in which the DNA polymerase attaches and replicates the complementary sequence. Multiple cycles of PCR can eventually create billions of copies of the target DNA in question.
+
-
Michael Margolis’ parents came and unloaded a large quantity of lab equipment for our use. We also spent some time cleaning the equipment as they were fairly unclean. This included tasks such as cleaning a large mess of agar in the microwave, which took at least 20 minutes. Although it was quite labor-intensive, we were very happy to do the work because we acquired a large amount of lab equipments we couldn’t have otherwise afforded.
+
-
Attendance: Peter, Brian, Sarah, Gha Young, Brandon, Mokhshan, Cindy, Hope, Michael, Nicki, Minh, Tareq, Spencer, Dan, Mrs. Margolis (Thanks!)
+
-
Monday December 10th - Gel electrophoresis day. Today we used our digested pAMP plasmids from lab 9 and checked our work through gel electrophoresis. The theoretical idea behind the process is detailed below, but for the practical idea we must go into how to prepare the test.  
+
        <div class="slider-wrapper theme-default">
-
Step 1: Prepare the Agarose gel: (whoever was in this group, please detail the process for the rest of us here)
+
            <div class="ribbon"></div>
 +
            <div id="slider" class="nivoSlider">
 +
                <img src="https://static.igem.org/mediawiki/2013hs/a/ac/Geisel.jpg" width="450"/>
 +
                <img src="https://static.igem.org/mediawiki/2013hs/c/ce/Slideshow1.jpg" width="450"/>
 +
                <img src="https://static.igem.org/mediawiki/2013hs/3/35/Sunset-web.jpg" width="450"/>
 +
                <img src="https://static.igem.org/mediawiki/2013hs/a/af/Balpark.jpg" width="450"/>
 +
                <img src="https://static.igem.org/mediawiki/2013hs/0/07/Spenceandbran.jpg" width="450"/>
 +
                <img src="https://static.igem.org/mediawiki/2013hs/b/bd/Gaslamp-condos-lofts1.jpg" width="450"/>
 +
                <img src="https://static.igem.org/mediawiki/2013hs/0/07/Sunset2-web.jpg" width="450"/>
-
Results of the Gel Electrophoresis:
 
-
Explanation: The string of bands closest to the top of the picture is the DNA ladder, used as a ruler to measure the specific base pair length of the digested DNA. The 2 rows below are our digestion solutions, or pAMP plasmids that have been cleaved in 2 specific points by the restriction enzymes BamHI and HindIII. The fact that one row is split into two fragments means that the digestion for this particular Ampicillin resistance plasmid was successful, for the plasmid fragmented into 2 pieces of different sizes, therefore one will go further when the negative DNA is pushed through the gel by the negative charge. The row closest to the bottom of the picture however is an example of an unsuccessful digestion. For the plasmid remained intact and there is only one band. The gel has been removed and is being refrigerated for further use next time on the side while we're splitting into groups of three and doing lab 10 together
+
            </div>
 +
    </div>
 +
    <script type="text/javascript">
 +
  $(window).load(function() {
 +
        $('#slider').nivoSlider();
 +
    });
 +
    </script>
 +
<br>
 +
<div id="fb-root"></div>
 +
<script>(function(d, s, id) {
 +
  var js, fjs = d.getElementsByTagName(s)[0];
 +
  if (d.getElementById(id)) return;
 +
  js = d.createElement(s); js.id = id;
 +
  js.src = "//connect.facebook.net/en_US/all.js#xfbml=1";
 +
  fjs.parentNode.insertBefore(js, fjs);
 +
}(document, 'script', 'facebook-jssdk'));</script>
 +
<div class="fb-like" data-href="https://2013hs.igem.org/Team:TPHS_SanDiego" data-send="true" data-width="600" data-show-faces="false" data-font="arial"></div>
 +
</div>
 +
<div class="row-end"></div>
 +
</div>
-
January 14th:
+
<div class = "row">
 +
<div class="col12-3">
 +
<p style="font-family:Georgia;color:black;font-size:16px;"> <b>Attributions:</b></p>
 +
<p style="font-family:Georgia;color:black;font-size:12px;"> All experiments explained here were done by the TPHS students, any previously existing plasmids and materials were supplied by Spencer Scott and the Hasty Lab at UCSD. The plate reader data acquisition was done at a lab where the high school students could not enter, but they are versed on every step of the process. The website layout was adapted from Berkeley iGEM 2011's wiki with their permission. Almost all edits were done by members of the high school team, including the home page, project page, protocols page, daily journal, safety page, and much of the team page. Some things such as the team photos and the parts page were done by Spencer Scott as an instructive lesson on design and using Illustrator and Photoshop. Anything done by an advisor was done as a teaching lesson with close interaction with the students at all times.
 +
</div>
 +
<div class="row-end"> </div>
 +
</div>
-
More brainstorming was done for the competition. We got down some more ideas. Someone brought up something about STD, but this idea got denied since there was no humane way to do the experiment. See Project Design.
+
<div class="row">
 +
<div class="col12" id="spacer"></div>
 +
<div class="row-end"> </div>
 +
</div>
-
January 18th:
+
<div class = "row">
-
We decided who will go to the UCSD (Tareq, Gha Young, Brian, and Nicki). Spencer has planned the project for us; unfortunately, he could not come today to explain it. We will get it in the next meeting, which will be held on January 25th.
+
<div class="col12-3" style="background-color:#499394">
 +
<p style="text-align:center; color:#CECECE; font-size:13px; font-weight:bold; padding:3px"> The Torrey Pines High School iGEM team would like to thank New England Biolabs, the UCSD Biodynamics Labratory, and Mr. Brinn Belyea. </p>
 +
</div>
 +
<div class="row-end"> </div>
 +
</div>
-
January 25th 2013:
 
-
Skype call with Spencer who detailed our project about promoters, activators and repressors. We studied the possibility of manipulating the position of the activator/repressor binding site so that repressors could possibly act as activators. We discussed the first step of the process which was to create a reporter plasmid so that we could measure the intensity of the expression, or in other words, measure the strength of promoter. We discussed three requirements of plasmids which were the origin site, the “part” gene, and the resistance marker. We then tackled the problem of isolating the promoter, which we decided to introduce a restriction enzyme site for restriction enzyme XBaI. This was so that introducing XBaI would split this restriction enzyme site in a palindromic fashion thus creating sticky ends. Then, we could introduce primers that we would design using ApE. This would allow the RNA polymerase to locate the primer and thus create a copy of a promoter. To create multiple copies of promoters, we would use PCR. By varying the distance of base pairs that the promoter sequence would have, the affinity that promoters would have for the RNA polymerase would vary and be measured by the visual prevalence of GFP gene expression.
+
<div class="row">
 +
<div class="col12" id="spacer"></div>
 +
<div class="row-end"> </div>
 +
</div>
-
JOBS!  1/28/13 (Meeting at Tareq’s House)
+
<div class = "row">
-
 
+
<div class="col12-3" >
-
Primer design; we discussed ApE, fixed members’ bugs, and looked at Mokhshan’s primer design.
+
<img src="https://static.igem.org/mediawiki/2013hs/0/0d/LifeTechSponsor.png" width="300" >
-
Job specifications:
+
<img src="https://static.igem.org/mediawiki/2013hs/3/38/NEBSponsor.png" width="300" >
-
 
+
<img src="https://static.igem.org/mediawiki/2013hs/d/d7/BDLLogo.png"width="300">
-
Stock/Inventory/labelling
+
<div class="row-end"></div>
-
Michael, Gha Young, Hope, Naim
+
</div>
-
Supervisor
+
-
Nicki
+
-
Cleanup
+
-
Everyone
+
-
Fund hunters
+
-
Tareq, Naim, Nicki, Brandon
+
-
Lab technicians (maintaining lab equipments, website management, and computer help)
+
-
Gha Young, Mokhshan, Brian, Tareq, Michael
+
-
Reporters
+
-
Brian, Naim, Michael
+
-
Setup
+
-
Tareq, Nicki, Gha Young (maybe)
+
-
3. Fund hunting planned out!
+
-
- Eppendorf
+
-
- Samsung
+
-
- Life Science Institute
+
-
- Craig venter Research Institute
+
-
- Salk Institute
+
-
- Scripps Research Institute
+
-
- Sanford Burnham Institute
+
-
- UCSD
+
-
- Intel
+
-
- Sanford Consortium for Regenerative Science
+
-
 
+
-
1 Feb. 2013
+
-
1. We got a kick start in our inventory!
+
-
-See Inventory
+
-
2. Spencer told us about the primer sequence we will be using for our project.
+
-
 
+
-
4 Feb. 2013
+
-
We got the PCR machine called Perkin Elmer Cetus 480 today. The machine has a program that consists of steps where we can input data in order to regulate a PCR in a certain way. It also asks for user number and file number. The user number used for simulation is 51. The numbers for the soak file, extension file, cycling file, and final extension file are 51,52,53, and 54, respectively.
+
-
 
+
-
51-Soak File
+
-
Temperature - 98 oC
+
-
 
+
-
52-Extension File
+
-
Temperature - 98oC; Time - 0 min. 30 sec.
+
-
 
+
-
53-Cycling File
+
-
Seg. 1: Temperature - 98oC; Time - 0 min. 01 sec.
+
-
Seg. 2: Temperature - 98oC; Time - 0 min. 10 sec.
+
-
Seg. 3: Temperature - 60oC; Time - 0 min. 01 sec.
+
-
Seg. 4: Temperature - 60oC; Time - 0 min. 30 sec.
+
-
Seg. 5: Temperature - 72oC; Time - 0 min. 01 sec.
+
-
Seg. 6: Temperature - 72oC; Time - 0 min. 30 sec.
+
-
Cycles: 35 times
+
-
 
+
-
54-Final Extension File
+
-
Seg. 1: Temperature - 72oC; Time - 0 min. 01 sec.
+
-
Seg. 2: Temperature - 72oC; Time - 10 min. 00 sec.
+
-
Seg. 3: Temperature - 4oC; Time - [HOLD]
+
-
 
+
-
8 Feb. 2013
+
-
tp001f GCTGATCTAGAGGATCTTAGCTACTAGAGAAAGAGGAGAAATACTAG
+
-
tp002r TATACTCTAGAGAACCTGCCGTTTCTTGAGTTGC
+
-
 
+
-
===Results/Conclusions===
+
-
What did you achieve over the course of your semester?
+
-
 
+
-
 
+
-
===Safety===
+
-
What safety precautions did your team take? Did you take a safety training course? Were you supervised at all times in the lab?
+
-
 
+
-
 
+
-
===Attributions===
+
-
Who worked on what?
+
-
 
+
-
 
+
-
===Human Practices===
+
-
What impact does/will your project have on the public? 
+
-
 
+
-
 
+
-
===Fun!===
+
-
What was your favorite team snack?? Have a picture of your team mascot?
+
 +
</div>
 +
</html>
-
<forum_subtle />
+
{{Team:Berkeley/header}}
 +
{{Team:Berkeley/css}}
 +
{{Team:Berkeley/navigation}}

Latest revision as of 04:03, 22 June 2013

Berkeley iGEM 2011

header
Mercury

In an effort to expand the toolkit available to synthetic biologists, we've taken a system natively responsible for transcriptional activation and modified it to control transcriptional repression. The LasR system from Pseudomonas Aeruginosa requires the presence of a small molecule, C12-3-oxo-AHL, to induce activation of the Plas promoter. By modifying the -10 and -35 sites of the promoter, as well as shifting the location of the LasR binding sites, the new Plas promoter (Plas*) was changed from an inducible to a repressible promoter. Through adding this second functionality, the Plas* promoter could be used in conjunction with a wildtype Plas promoter to control two separate genes whose expression levels are always out of sync. Furthermore, if the bacteria are transfected with a plasmid encoding LasI, the bacteria will be able to turn off gene expression at a critical population density, instead of only being able to turn on gene expression.

Proteins discovered in Jellyfish that have the ability to emit fluorescence.

A clever way to normalize protein expression across cell populations.

A quorum sensing system from Pseudomonas aeruginosa.

Re-engineering the Plas promoter's response to LasR.


We have all been brought together by a mutual interest for synthetic biology. It fascinates us how easily organisms can be tweaked and altered to our liking in this expansive field, so we thought it’d be best get started early. Through reading, lectures, mentorship and hands on experience we opened our minds and fueled our thirst for control over these malleable organisms. We functioned well together and played each other’s strengths for maximum efficiency while simultaneously having the time of our lives. We have learned much and hope to keep putting our best efforts forward till the very end.


Attributions:

All experiments explained here were done by the TPHS students, any previously existing plasmids and materials were supplied by Spencer Scott and the Hasty Lab at UCSD. The plate reader data acquisition was done at a lab where the high school students could not enter, but they are versed on every step of the process. The website layout was adapted from Berkeley iGEM 2011's wiki with their permission. Almost all edits were done by members of the high school team, including the home page, project page, protocols page, daily journal, safety page, and much of the team page. Some things such as the team photos and the parts page were done by Spencer Scott as an instructive lesson on design and using Illustrator and Photoshop. Anything done by an advisor was done as a teaching lesson with close interaction with the students at all times.

The Torrey Pines High School iGEM team would like to thank New England Biolabs, the UCSD Biodynamics Labratory, and Mr. Brinn Belyea.


Retrieved from "http://2013hs.igem.org/Team:TPHS_SanDiego"