Team:BV CAPS Kansas/Project/Methods
From 2013hs.igem.org
(Difference between revisions)
Meaton2222 (Talk | contribs) |
Meaton2222 (Talk | contribs) |
||
Line 1,165: | Line 1,165: | ||
Two separate methods for getting the appropriate restriction sites on the PLC-5 gene were considered. <br> | Two separate methods for getting the appropriate restriction sites on the PLC-5 gene were considered. <br> | ||
<b>PCR AND SITE-DIRECTED MUTAGENSIS</b> | <b>PCR AND SITE-DIRECTED MUTAGENSIS</b> | ||
- | <br> | + | <br>Site-directed mutagenesis is a method for altering the sequence of DNA and can be used to produce both point and frame-shift mutations. In this case, it was possible to take advantage of codon redundancy and alter the DNA sequence without altering the amino acid sequence. It was necessary to do site-direct mutagenesis because the pyruvate kinase gene contains in its sequence two PstI restriction sites. <br> |
+ | Because PSTI is part of biobrick assembly, it was necessary to use site-directed mutagenesis to remove these sites prior to cleaving and ligating the part. Otherwise PstI would chop the gene to pieces whenever we (or anybody else) tried to assemble anything with it. <br> | ||
+ | Primer design was very simple, as the primers were identical to the gene except that they contained the desired mutations. Again, the primers were about 20 bp to ensure that they would only attach to one region along the gene. <br> | ||
<i>Forward primer</i><br> | <i>Forward primer</i><br> | ||
5’-<font color="red"> GTTTCTTGGAATTCGCGGCCGCTTCTAGATG </font> <font color="green"> TCAAAGTCCCACAGTGAAGC</font> -3’ | 5’-<font color="red"> GTTTCTTGGAATTCGCGGCCGCTTCTAGATG </font> <font color="green"> TCAAAGTCCCACAGTGAAGC</font> -3’ | ||
Line 1,190: | Line 1,192: | ||
In the event of the failure of these super-long primers to anneal properly, it would also be possible to construct the restriction site flanks through multiple rounds of PCR, though this would be more time-consuming. <br> | In the event of the failure of these super-long primers to anneal properly, it would also be possible to construct the restriction site flanks through multiple rounds of PCR, though this would be more time-consuming. <br> | ||
<b>GIBSON ASSEMBLY</b> | <b>GIBSON ASSEMBLY</b> | ||
- | <br> | + | <br>TIt would have also been possible to construct the PCL-5 gene entirely from oligos using Gibson assembly. The artificial synthesis of the approximately 1500-bp gene would require four oligos of single-stranded DNA. The ends of these oligos would contain small section of overlapping sequence, and could be annealed together, with DNA polymerase and DNA ligase completing and sealing the double strand. After this point, it would be possible to proceed with standard PCR. <br> |
- | <br>The primary advantages of Gibson assembly included the fact that it would be possible to build the BioBrick restriction sites and altered PstI sites into the oligos. This is far simpler than using site-directed mutagenesis and PCR; however, ordering (and waiting for the synthesis of) such long oligos would actually be more time-consuming than using PCR and site-directed mutagenesis. | + | The primary advantages of Gibson assembly included the fact that it would be possible to build the BioBrick restriction sites and altered PstI sites into the oligos. This is far simpler than using site-directed mutagenesis and PCR; however, ordering (and waiting for the synthesis of) such long oligos would actually be more time-consuming than using PCR and site-directed mutagenesis. |
Revision as of 20:59, 20 June 2013
BV CAPS iGEM Tweets
Methods
Editing Restriction Sites
Two separate methods for getting the appropriate restriction sites on the PLC-5 gene were considered.PCR AND SITE-DIRECTED MUTAGENSIS
Site-directed mutagenesis is a method for altering the sequence of DNA and can be used to produce both point and frame-shift mutations. In this case, it was possible to take advantage of codon redundancy and alter the DNA sequence without altering the amino acid sequence. It was necessary to do site-direct mutagenesis because the pyruvate kinase gene contains in its sequence two PstI restriction sites.
Because PSTI is part of biobrick assembly, it was necessary to use site-directed mutagenesis to remove these sites prior to cleaving and ligating the part. Otherwise PstI would chop the gene to pieces whenever we (or anybody else) tried to assemble anything with it.
Primer design was very simple, as the primers were identical to the gene except that they contained the desired mutations. Again, the primers were about 20 bp to ensure that they would only attach to one region along the gene.
Forward primer
5’- GTTTCTTGGAATTCGCGGCCGCTTCTAGATG TCAAAGTCCCACAGTGAAGC -3’
Reverse Primer
To orient the sequence 5’-to-3’, it was necessary to use the reverse compliment of the last twenty base pairs of the gene.
5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTA TTATTACGGGACGGGCACCACGCGCA -3’
(Red is the tails, green is the gene)
After this, it would be possible to proceed with PCR as normal, and though the region of restriction sites would “hang off” in the first round of PCR, they would be added to the PLC-5 gene as “flanks” in subsequent rounds. However, a number of challenges presented themselves. First and foremost, the PLC-5 gene contains in its sequence two PstI restriction sites. It was necessary to use site-directed mutagenesis to remove these sites prior to cleaving and ligating the part, as the PstI would chop PLC-5 to pieces.
Site-directed mutagenesis is a method for altering the sequence of DNA and can be used to produced both point and frame-shift mutations. In this case, it was possible to take advantage of codon redundancy and alter the DNA sequence without altering the amino acid sequence. Primer design was also very simple, as the primers were identical to the gene except that they contained the desired mutations. Again, the primers were about 20 bp to ensure that they would only attach to one region along the gene.
Forward primer
Template strand- 5’- ctcatctccctgcaggtgaagcag 3’
Primer -5’- ctcatctccctccaggtgaagcag 3’
(Restriction sites are in red, point mutation is in blue)
Reverse primer
Again, the reverse primer necessitated the use of the reverse compliment of the original sequence.
Template strand 5’- CTGCTTCACCTGCAGGGAGATGAG -3’
Primer 5’- CTGCTTCACCTGCAGGGAGATGAG 3’
The second problem concerned the length of primers, which at 51 and 55 bp, far exceeded the typical 40-45 bp. The long “free ends” that contained the restriction sites threatened to rip the section of matching sequence away from the template strand. It proved impossible to shorten these primers while still including the standard restriction site. Nonetheless, the primers were ordered and the experiment was attempted.
In the event of the failure of these super-long primers to anneal properly, it would also be possible to construct the restriction site flanks through multiple rounds of PCR, though this would be more time-consuming.
GIBSON ASSEMBLY
TIt would have also been possible to construct the PCL-5 gene entirely from oligos using Gibson assembly. The artificial synthesis of the approximately 1500-bp gene would require four oligos of single-stranded DNA. The ends of these oligos would contain small section of overlapping sequence, and could be annealed together, with DNA polymerase and DNA ligase completing and sealing the double strand. After this point, it would be possible to proceed with standard PCR.
The primary advantages of Gibson assembly included the fact that it would be possible to build the BioBrick restriction sites and altered PstI sites into the oligos. This is far simpler than using site-directed mutagenesis and PCR; however, ordering (and waiting for the synthesis of) such long oligos would actually be more time-consuming than using PCR and site-directed mutagenesis.
Tinker Cell
A program called TinkerCell was utilized to help visualize the steps taken through glycolysis and the fatty-acid pathway to create alkanes. The image created in TinkerCell allows one to see each step in the modification of a molecule. Beginning with glucose and ending with alkanes, the image shows what the molecule becomes, which enzyme catalyzes the reaction, what type of reaction occurs, what is required for the reaction to occur, and the other products of the reaction.