"
Team:TPHS SanDiego/Log
From 2013hs.igem.org
Notebook
Daily Journal
October 4 - Tareq gave us an overview of the club and information about the iGEM competition. Meetings will be every Monday after school in Mr. Belyea’s room.
October 15 - Today was our first meeting. We went over the sterilizing procedure involving passing objects over a “fire” from a lighter. We also learned how to use a micropipette.
October 22 - We prepared agar plates; half the plates with ampicillin mixed in and the other half without. The plates were labeled and put into the incubator.
October 29 - We discussed the procedure for inserting the plasmid pGREEN into the E coli.
November 2 - We completed the pGREEN lab today with the E coli. Results will be revealed on Monday.
November 5 - The results were unsatisfactory. None of the E coli. had absorbed the plasmid. The bioluminescence plasmid we had included did not cause it to glow green when we shined the ultraviolet light upon the plates. We will try again at the next meeting. Our weekly meetings have changed, and we will now meet twice a week, Monday and Friday. In addition, we looked at last year’s iGEM competition team wikis. We started to brainstorm some ideas for our project.
November 9 - Some new members came today. We taught them the basic procedures we had learned on the first day. Then, we repeated the pGREEN lab. This time we were more precise about the temperature of the heat shock and the timing of the tubes on ice. Hopefully this helps our success rate increase. Results will be revealed on Monday.
November 13 - The results are satisfactory. Two groups achieved the proper results with the pGREEN plasmid absorbed into the E coli. It glows green with the ultraviolet light. Afterwards, a letter to the parents was distributed to the team to take home. We went over the procedure for inserting two genes into a plasmid using restriction enzymes and DNA ligase. We will perform the lab at the next meeting.
November 16 - Meeting cancelled last minute due to our advisor being busy. Tareq informed us that there will be a mandatory parent’s meeting on Monday November 26th in the lecture hall at 6:30 PM.
November 26 - We carried out Lab 9, where we used restriction enzymes to cut plasmids in certain places. We were informed today that we have a mentor; Spencer Scott!
November 30- We met Spencer Scott, a UCSD graduate and our mentor, for the first time. Discussed possible feasibility of our proposed project. Digested and ligated pAMP and pKAN plasmids.
December 3rd- We proceeded with Lab 3, DNA restriction analysis. We cut Lambda DNA at 9 different sites with 2 different restriction enzymes, BamHI and HindIII (pronounced like Hind), and then used gel electrophoresis to check our work. With the help of our mentor Spencer, and his colleague John, we learned how to mix and cast 0.8% agarose gel, create wells in it, properly submerge the gel in a chamber full of electrophoresis buffer, and to fill the wells with minimal error/damage to the agarose gel. John delivered two lectures, one on the properties of how enzymes denature when heated and how that relates to hydrogen bonds, and the other on how restriction enzymes work, and how we will be using them throughout the iGEM competition. In the end we were not able to analyze the results of our gel electrophoresis due to time constraints; however, we now all know the basics of gel electrophoresis. John stressed the need for a laboratory notebook, so everyone will now bring a small notebook with them for lab notes. John told us, “In science you’re going to make a lot of mistakes, but it will be meaningless if you learn nothing from them.”
December 7th - In place of a lab, we devoted our attention to the theory behind the procedure. Spencer Scott and our supplementary mentor Dan lectured us about how synthetic biology is done. The basic premise of the lecture was to cover the entirety of the clone cycle, which consists of PCR (polymerase chain reaction) which will be detailed in the paragraph below, digestion (using restriction enzymes to fragment plasmids), ligation (using DNA ligase to join the digested fragments), transformation (making the E.coli take the plasmid), extraction from the E.coli itself then from the Agarose used in gel electrophoresis, and purification (isolating the specific gene that we need). PCR consists of multiple cycles of three basic steps: denaturation, annealing, extension. Denaturation unzips the DNA, annealing attaches the primers to the specific part of the genome that you want, primers are things that tell the DNA polymerase (the component that makes complementary sequences for the target DNA) where to begin. Extension, the process in which the DNA polymerase attaches and replicates the complementary sequence. Multiple cycles of PCR can eventually create billions of copies of the target DNA in question. Michael Margolis’ parents came and unloaded a large quantity of lab equipment for our use. We also spent some time cleaning the equipment as they were fairly unclean. This included tasks such as cleaning a large mess of agar in the microwave, which took at least 20 minutes. Although it was quite labor-intensive, we were very happy to do the work because we acquired a large amount of lab equipments we couldn’t have otherwise afforded.
December 10th - We performed gel electrophoresis. Using our digested pAMP plasmids, we checked our work from lab 9 through gel electrophoresis. The theoretical idea behind the process is detailed below, but for the practical idea we must go into how to prepare the test. Step 1: Prepare the Agarose gel:
Results of the Gel Electrophoresis:
 |
Explanation: The string of bands closest to the top of the picture is the DNA ladder, used as a ruler to measure the specific base pair length of the digested DNA. The 2 rows below are our digestion solutions, or pAMP plasmids that have been cleaved at 2 specific points by the restriction enzymes BamHI and HindIII. The fact that one row is split into two fragments means that the digestion for this particular Ampicillin resistance plasmid was successful, since the plasmid fragmented into 2 pieces of different sizes, therefore one will go further when the negative DNA is pushed through the gel by the negative charge. The row closest to the bottom of the picture, however, is an example of an unsuccessful digestion. The plasmid remained intact and only one band appeared. The gel was removed and was refrigerated for further use. |
|---|
'WINTER BREAK
January 14th - Brainstorming for the competition continued, and we came up with more ideas. See Project Design.
January 18th - We decided who will go to the UCSD (Tareq, Gha Young, Brian, and Nicki). Spencer has planned the project for us; unfortunately, he could not come today to explain it. We will get it in the next meeting, which will be held on January 25th.
January 25th - Skype call with Spencer who detailed our project about promoters, activators and repressors. We studied the possibility of manipulating the position of the activator/repressor binding site so that repressors could possibly act as activators. We discussed the first step of the process which was to create a reporter plasmid so that we could measure the intensity of the expression, or in other words, measure the strength of promoter. We discussed three requirements of plasmids which were the origin site, the “part” gene, and the resistance marker. We then tackled the problem of isolating the promoter, which we decided to introduce a restriction enzyme site for restriction enzyme XBaI. This was so that introducing XBaI would split this restriction enzyme site in a palindromic fashion thus creating sticky ends. Then, we could introduce primers that we would design using ApE. This would allow the RNA polymerase to locate the primer and thus create a copy of a promoter. To create multiple copies of promoters, we would use PCR. By varying the distance of base pairs that the promoter sequence would have, the affinity that promoters would have for the RNA polymerase would vary and be measured by the visual prevalence of GFP gene expression.
January 28th - Meeting at Tareq’s House. We discussed primer design, fixed members’ bugs concerning the program ApE, and looked over Mokhshan’s primer design. We also established responsibilities for each team member.
Febuary 1st - We took inventory. Spencer explained to us the primer sequence we will be using for our project.
Febuary 4th - We acquired a PCR Thermocycler, Perkin Elmer Cetus 480 today. The machine has a program that consists of steps where we can input data in order to regulate a PCR in a certain way. It also asks for user number and file number. The user number used for simulation is 51. The numbers for the soak file, extension file, cycling file, and final extension file are 51,52,53, and 54, respectively.
| Soak File - #51 | Brings Temperature from Room to 98 degrees Celcius. |
|---|
| Extension File - #52 | Holds temperature at 98 degrees Celcius for 30 seconds so that the DNA Strands can temporarily separate from one another. |
|---|
PCR Cycler File - #53 |
|
|---|---|
| Segment 1 |
|
| Segment 2 |
|
| Segment 3 |
|
| Segment 4 |
|
| Segment 5 |
|
| Segment 6 |
|
| Number of Cycles |
|
| Final Extension File - #54 | |
|---|---|
| Segment 1 |
|
| Segment 2 |
|
| Segment 3 |
|
February 8th- These were the primers that we plan to anneal to our plasmid during the PCR Process.
| Forward Primer Sequence: | GCTGATCTAGAGGATCTTAGCTACTAGAGAAAGAGGAGAAATACTAG |
|---|---|
| Reverse Primer Sequence: | TATACTCTAGAGAACCTGCCGTTTCTTGAGTTGC |
February 14th - We added the phusion DNA polymerase with its buffer and ran the PCR with our primers. It was supposed to be run in 35 cycles; however, due to time constraints, It was ran in 30 cycles, which took about 1.5 hrs.
February 19th - Gel electrophoresis was done to test if the PCR worked.
To make your 0.8 % gel:
-Add 0.8 grams agarose to 100 ml TAE buffer
-Microwave until clear (1.5-2 min)
-Add 10 ul of gel red
-Insert well comb and let set
Add appropriate quantities of loading dye to samples and let set.
After the gel electrophoresis was run for 20 minutes, we shut off the lights and turned on the UV lights. Two distinctly separate bands of DNA were observed, indicating that PCR was successful.
February 20th - Video idea finalized for fundraising on indiegogo, we took a few panoramic shots of the lab for the video, and decided on how we should go about attracting donors on the site,
$0-10= donor list
$30= name on t-shirt
$50= name on footer of website
February 22nd - Tareq did the gel clean up during lunch, and we altogether did the PCR clean up after school. We did this using protocols given to us. Our mentor, Dan, also came today to help us out and answer our questions. He showed us a picture of fluorescent chromosomes. According to him, the colors (red,green,cyan,purple) should be distinctly adjacent so that indication of gene position can be easily done. In his example image, there was a great proportion of white color. The white color is caused by overlapping of multiple colors.
We worked on the Indiegogo site, figuring out how we are going to film the video and what perks will be available to the donors. We wrapped up the today’s meeting by running a denaturation process for XBaI restriction enzyme using the PCR machine at 65 deg Celsius.
February 25th - During lunch, Tareq streaked the DNA. After school, we took 100 microliters of competent cells and mixed them with 10 microliters of Luria Broth. We put the mixture into the thermocycler at 42 degrees celcius. Then, we did agar plates.
February 27th - The transformation that we performed last meeting failed. We hypothesized that doing transformation for only an hour instead of hour and a half caused this failure. So, we did transformation again. Tareq did the PCR during lunch. Afterschool, we did PCR cleanup and tested if the PCR worked by doing gel electrophoresis. We flashed the UV light and observed that the PCR worked.
Results of the Gel Electrophoresis:
 |
|
|---|
March 4th - We did transformation for the new cells. THE CELLS SHOULD BE STIRRED USING THE TIP OF THE PIPETTE
March 6th - The cell somehow didn’t work as we expected. We will be discussing the causes for the failure when we meet with our mentor, Spencer, on Friday. We worked on our shots for the fundraising.
March 8th - Spencer told us through Tareq that our cells did not work in the way we wanted because he may have given us the wrong template. Spencer and Dan came to the meeting to help us with our lab with some new template. We ran the PCR, did PCR Cleanup, performed Digestion with XbaI, made gel and ran the gel electrophoresis. In the first column, we added DNA ladder, third one the PCR product #1, fifth one the template, and seventh one the PCR product #2. We concluded that the PCR worked by testing the gel with the UV light. New Procedure:
Step 1: PCR
Follow the protocol -> amplifying and adding XbaI Site. Run in thermocycler with this protocol: [TIME(min. : sec.)] / [TEMPERATURE(˚C)] 0:30 / 98
[30 CYCLES]---------
0:10 / 98 0:20 / 58 0:45 / 72
5:00 / 72 HOLD / 4 Then, we want to put it in the freezer ASAP!! Take ~4μL of PCR product and run on gel to ensure success Step 2: PCR CLEAN UP
Follow protocol
Step 3: Digestion with XBaI
Follow protocol DEACTIVATE ENZYME
Step 4: Run entire digest on gel (multiple wells?)
Visualize bands Cut out Gel Purify Nanodrop! Step 5: Ligate -> 30 min.
Protocol (10μL reaction)
Step 6: Transform -> plate
Comp Cells Protocol
60 μL ON-culture into 3 mL LB grow ~2.5 hrs Spin down Resuspend in 100 μL TSS by pipetting up and down
Step 7: Pick 4 colonies into 3 mL LB
Grow overnight in 37℃ shaker.
Step 8: Mini-prep for on-cultures
Step 9: Send for Sequencing (Bring to Spencer!)
Use primers ca998 and g00101
March 11th - We made two new sets of overnight culture.
March 12th - We made competent cells and then did the transformation and ligation. We assigned shifts for Tuesdays, Wednesdays, and Thursdays. Either Monday or Friday will become a mandatory day for everyone.
March 15th - The transformation was successful. We know this because the cells grew in the ampicillin agar plates meaning they have taken up the appropriate resistance gene. Now we must test whether or not our XbaI restriction binding site was properly attached. We did Mini prep for the cells. A process in which we isolate the plasmids within the cell. John and Dan came today to help us. When the gel electrophoresis was run, however, we observed two bands on one of the products. We diagnosed that the problem was the harvesting method. The protocol stated to harvest 6 colonies. However, we harvested the colonies and then pooled them all in 1 suspension culture. This meant that if in 1 colony a plasmid had recircularized, there would be two different plasmids. Therefore, when we mini-prepped and ran the gel, we used two different plasmids as opposed to the single plasmid that we should have used. Thats why we got 2 different bands. We now know to assign 1 colony per tube and mini prep all 6. We scheduled Monday to grow new cells and Tuesday to do the mini prep again so that we’d have a new results by next Friday.
March 18th - We grew new cells as scheduled. We will do mini prep for the cells tomorrow.
March 19th - We mini-prepped the cells today. The results of the mini-prep (tested by gel electrophoresis) was unexpected. When we shined UV light on the gel, nothing showed up. Then, we immediately realized that we forgot to add Gel Red, which causes DNA to show orange color under UV light. Fortunately, we do not have to start the mini-prep all over again, since we still have the mini-prepped cells. Tareq scheduled that he will redo the gel electrophoresis at tomorrow lunch.
Mar. 21st - We prepared for the digestion for the cells. Then, we did gel electrophoresis (this time we included Gel Red) for the old mini-prepped cells. We observed two bands of DNA from the wells that corresponded to 1A, 1B, 2A, and 2B. Other wells corresponding to 3A, 3B, 4A, and 4B did not show two bands of DNA; therefore, those did not work in the way they were supposed to. Tareq will be doing the digestion at his home, and we will altogether do gel electrophoresis for the digested cells on Monday.
Mar. 25th - We did gel electrophoresis for the digested cells. To make the gel, we added .500g of agarose, 50.0 mL of DDW, and 20 micro-liters of Gel Red later on. Somehow, we observed that the gel was too pink. However, since the gel worked out fine, we hypothesized that high concentration of Gel Red in the gel did not affect the process significantly. The first DNA ladder did not show up conspicuously when we shined UV light. We will be doing gene-mapping on Wednesday.
Apr. 5th - Spencer and John came in, and briefed us on the next step, we digested our DNA in EcoR1, we did this so we could answer why we had 2 bands showing up when we ran our mini-preps on the gel, as it turned out, the circular DNA folded on itself, and split up certain strands from the others. We linearized the DNA by cutting it at the EcoR1 site and running it on the gel, it worked, we got a single band at the 3kb site on the ladder. Now we are sure the DNA we isolated was the plasmid we wanted, the next step is to determine whether or not the Xba1 site is on the plasmid, we will do this by sequencing over break.
Apr. 15th - We reflected upon Brandon and Mokhshan’s ventures over break, they delivered the mini-prep to spencer for sequencing, spencer then transformed and mini-prepped the colonies and we will know whether or not we were ultimately successful in adding the Xba1. From here on out we will be meeting every Monday, Wednesday and Friday, with mentors joining us on each day.
Apr. 19th - Plasmid Design: First we will design primers, the difference between the primers we are designing and the primers we designed before is that these primers are pointing towards one another, therefore amplifying the RFP gene without the rest of the plasmid, basically designed for normal PCR as opposed to inverse PCR. Then we will add it to our template, or vector backbone, which has the GFP gene as well as our introduced XbaI gene, using PCR again (ask john specifically about how the Promoter-RFP-Terminator gene is added to the GFP backbone). This will result in 1 plasmid with 2 fluorescent protein genes on it, unfortunately, fluorescent protein genes like GFP/RFP share a lot of DNA, the cell recognizes this and deems it redundant, it cuts a gene out, which would be bad. Hey John, if you could write here what you were saying about having 2 plasmids that we insert simultaneously? Thanks. The solution to this problem is to utilize the nature of the origin site in the plasmids. p15A is a medium copy number ori,
The how and why to using a two plasmid system: (this is a little long, but very important stuff) As mentioned above, all fluorescent proteins have highly similar DNA coding sequences because they’re all just slight mutations of the original GFP that was discovered in nature. If a plasmid has two fluorescent proteins on it, the cell can sometimes notice that there is a redundancy because so much of the sequence is similar and assumes that its DNA replication machinery made a mistake and copied the same thing twice, so it can ‘edit’ out one of the two fluorescent proteins. To avoid this, we are going to use a two plasmid system. The first plasmid you have already made, that is the one with the added cut sites around the promoter region and a downstream GFP. The way a cell recognizes plasmids is by their origin of replication (ORI). ORIs tell the cell how many copies of a plasmid to maintain (copy number) and it also tells the cell where to start replicating the plasmids from. ORIs come in three basic forms: low, medium, and high copy number. If you want to design two different plasmids to put in a cell, each plasmid must have a different ORI, otherwise the cell cannot tell the two apart and won’t know how many copies to have of each, so can you use a low and high, or medium and high, or low and medium, but you cannot use two high copies, or two medium copies, etc... The plasmid you already made has a pUC ORI which tells the cell to have about 200-300 copies of the plasmid. We’ll be adding a medium copy number plasmid call p15A which has a copy number of 10-15 with the constitutively expressed RFP as our internal control. Here is the biology behind this. Imagine I have a plasmid with a copy number of 6, meaning the cell maintains 6 copies of that plasmid at a time. When the cell divides, it puts three copies in one half and three in the other half, it divides, and then replicates the plasmids until it has 6 again in each cell. Now imagine I want to add a second plasmid with the same origin of replication to the cell. When I transform both plasmids into the cell, lets suppose the cell uptakes one copy of plasmid one and two copies of plasmid two. The cell recognizes the origin of replication on each plasmid and copies each of the plasmids to get back to a total of six plasmids in the cell. Now you have two copies of plasmid one and four copies of plasmid two. As the cell begins to divide, it can only recognize the plasmids by their ORI, so the cell randomly puts three of the plasmids in one half and three in the other half and then divides. You then end up with varying possible combinations of the two plasmids in the two cells after division. One cell may end up with both copies of plasmid one and one copy of plasmid two and the other cell may end up with only three copies of plasmid two. As cell division continues (and an E. coli cell divides about every 20 minutes) the combinations of the plasmids will be very diverse across your entire population of cells. This is a bad thing!!! So how do we solve this problem? We must use different combinations of ORIs to get the cell to maintain the appropriate number of each plasmid during division. Now let’s walk through an example. Suppose I have one plasmid with an ORI that codes for a copy number of six and a second plasmid with a different ORI that codes for a copy number of two. When the cell divides, it puts three copies of plasmid one in each side and it puts one copy of plasmid two in each side, it divides, and then replicates the plasmids back to having six of plasmid one and two of plasmid two. Every time it divides, it will end up with the appropriate combination of the two plasmids across the entire population!!! One final caveat to using a two plasmid system. How do you get the cells to want to keep both plasmids? Think about this for a second before reading on. OK. Did you figure it out? We use the antibiotic resistance as a selection marker, so for a two plasmid system, we need to be using a different antibiotic resistance gene on each plasmid. We use these selection markers because we grow the cells in the presence of the antibiotic and any cells that decide to get rid of our plasmids die. Let’s imagine that we have a two plasmid system, with different ORIs, but the same antibiotic resistance gene. If some of the cells decide to get rid of one of the two plasmids and others maintain both plasmids, how can you tell the two apart? You can’t! This is why we use a different antibiotic resistance gene on each plasmid. Now imagine both plasmids have different ORIs and different antibiotic resistance genes. If I grow these cells with both plasmids in the presence of both antibiotics, only the cells that maintain both plasmids will be able to survive because as soon as any cells decide to get rid of one of the plasmids, they no longer have the resistance to both of the antibiotics and they die! OK. Soak this in, this is truly foundational information for being a synthetic biologist.
How its done: Sanger Sequencing PCR with ddntps and dntps, ddntps are labeled fluorescently. DNA has a hydroxyl group that the phosphorus group binds to, thats how we get the chain of DNA. Ddntps terminate the chain during DNA replication in PCR, by terminating the replication of sequences at random lengths. Dntps are used to build them, and ddntps are used to stop the replication and give off a fluorescence, the color of which is dependant upon what was the last base pair being coded when the sequence was terminated. Mass spectroscopy is the method used to measures the color, it also measures the mass of the sequence. By doing this, you can sequence the entire plasmid, knowing it by every base pair. A little note on this: when you kinda “graph” this out using ApE, there is a crazy fluctuation of some sort at each end. This is telling that certainty of the identity of the base pairs is very low. And we get a low certainty because the mass spectroscopy cannot distinguish the difference of the masses, since the mass is huge at the ends. (e.g. it is very hard to distinguish between 1000 b.p. and 1001 b.p. ) I think this is not the everything that John said. Someone plz verify this/add more :). Little Note: Example #1: Limb-girdle muscular dystrophy type 2O (LGMD2O), which belongs to a group of rare muscular dystrophies, called dystroglycanopathies, which are characterized molecularly by hypoglycosylation of α-dystroglycan (α-DG), is caused by an alteration in the promoter region of the POMGNT1 gene (protein O-mannose β-1,2-N-acetylglucosaminyltransferase 1), which involves a homozygous 9-bp duplication (-83_-75dup). This mutation decreases the expression of the promoter, and less POMGNT1 mRNA and its protein are synthesized. This is caused by negative regulation of the POMGNT1 promoter by the transcription factor ZNF202 (zinc-finger protein 202). The mutation generates more repressor binding site, causing the LGMD2O. If the results of the project show that relocating a binding site decreases the repression rate, the project can be practiced to lower the synthesis of ZNF202 protein so that this muscular dystrophy can be cured.
April 28th - PCR amplify T7 Promoter-lanRFP-T7 terminator
100ul Reaction: 74 ul qH2O 20 ul Q5 buffer 2 ul dNTPs 0.5 ul of 100 uM (CM_R) pT7 -S primer 0.5 ul of 100 uM T7 term (p15A) -AS primer 2 ul 0.5 ng/ul MD005 (lanRFP plasmid DNA) 1 ul Q5
Annealing Temp: 63C Extension Time: 25s
PCR amplify p15A and Cm backbone
100 ul Reaction: 74 ul qH2O 20 ul Q5 buffer 2 ul dNTPs 0.5 ul of 100 uM Cm_R -AS primer 0.5 ul of 100 uM p15A -S primer 2 ul 0.5 ng/ul pTD103aiiA Cm 1 ul Q5
Annealing Temp: 63C Extension Time: 36s
