"
Team:TPHS SanDiego/Log
From 2013hs.igem.org
| Line 235: | Line 235: | ||
<p> </p> | <p> </p> | ||
| - | + | '''February 8th''' | |
| + | |||
These were the primers that we plan to anneal to our plasmid during the PCR Process. | These were the primers that we plan to anneal to our plasmid during the PCR Process. | ||
<table width="879" border="0"> | <table width="879" border="0"> | ||
| Line 248: | Line 249: | ||
</table> | </table> | ||
</html> | </html> | ||
| - | |||
| - | |||
| - | |||
Revision as of 19:52, 10 February 2013
Notebook
Daily Journal
October 4 - Tareq gave us an overview of the club and information about the iGEM competition. Meetings will be every Monday after school in Mr. Belyea’s room.
October 15 - Today was our first meeting. We went over the sterilizing procedure involving passing objects over a “fire” from a lighter. We also learned how to use a micropipettor.
October 22 - We prepared agar plates; half the plates with ampicillin mixed in and the other half without. The plates were labeled and put into the incubator.
October 29 - We discussed the procedure for inserting the plasmid pGREEN into the E coli.
November 2 - We completed the pGREEN lab today with the E coli. Results will be revealed on Monday.
November 5 - The results were unsatisfactory. None of the E coli. had absorbed the plasmid. The bioluminescence plasmid we had included did not cause it to glow green when we shined the ultraviolet light upon the plates. We will try again at the next meeting. Our weekly meetings have changed, and we will now meet twice a week, Monday and Friday. In addition, we looked at last year’s iGEM competition team wikis. We started to brainstorm some ideas for our project.
November 9 - Some new members came today. We taught them the basic procedures we had learned on the first day. Then, we repeated the pGREEN lab. This time we were more precise about the temperature of the heat shock and the timing of the tubes on ice. Hopefully this helps our success rate increase. Results will be revealed on Monday.
November 13 - The results are satisfactory. Two groups achieved the proper results with the pGREEN plasmid absorbed into the E coli. It glows green with the ultraviolet light. Afterwards, a letter to the parents was distributed to the team to take home. We went over the procedure for inserting two genes into a plasmid using restriction enzymes and DNA ligase. We will perform the lab at the next meeting.
November 16 - Meeting cancelled last minute due to our advisor being busy. Tareq informed us that there will be a mandatory parent’s meeting on Monday November 26th in the lecture hall at 6:30 PM.
November 26 - We carried out Lab 9, where we used restriction enzymes to cut plasmids in certain places. We were informed today that we have a mentor; Spencer Scott!
November 30- We met Spencer Scott, a UCSD graduate and our mentor, for the first time. Discussed possible feasibility of our proposed project. Digested and ligated pAMP and pKAN plasmids.
December 3rd- We proceeded with Lab 3, DNA restriction analysis. We cut Lambda DNA at 9 different sites with 2 different restriction enzymes, BamHI and HindIII (pronounced like Hind), and then used gel electrophoresis to check our work. With the help of our mentor Spencer, and his colleague John, we learned how to mix and cast 0.8% agarose gel, create wells in it, properly submerge the gel in a chamber full of electrophoresis buffer, and to fill the wells with minimal error/damage to the agarose gel. John delivered two lectures, one on the properties of how enzymes denature when heated and how that relates to hydrogen bonds, and the other on how restriction enzymes work, and how we will be using them throughout the iGEM competition. In the end we were not able to analyze the results of our gel electrophoresis due to time constraints; however, we now all know the basics of gel electrophoresis. John stressed the need for a laboratory notebook, so everyone will now bring a small notebook with them for lab notes. John told us, “In science you’re going to make a lot of mistakes, but it will be meaningless if you learn nothing from them.”
December 7th - We decided to not focus our attention on a lab today, and instead devoted our attention to the theory behind the procedure. Spencer Scott and our additional mentor Dan lectured us about how synthetic biology is done. The basic premise of the lecture was to cover the entirety of the clone cycle, which consists of PCR (polymerase chain reaction) which will be detailed in the paragraph below, digestion (using restriction enzymes to fragment plasmids), ligation (using DNA ligase to join the digested fragments), transformation (making the E.coli take the plasmid), extraction from the E.coli itself then from the Agarose used in gel electrophoresis, and purification (isolating the specific gene that we need). PCR consists of multiple cycles of three basic steps: denaturation, annealing, extension. Denaturation unzips the DNA, annealing attaches the primers to the specific part of the genome that you want, primers are things that tell the DNA polymerase (the component that makes complementary sequences for the target DNA) where to begin. Extension, the process in which the DNA polymerase attaches and replicates the complementary sequence. Multiple cycles of PCR can eventually create billions of copies of the target DNA in question. Michael Margolis’ parents came and unloaded a large quantity of lab equipment for our use. We also spent some time cleaning the equipment as they were fairly unclean. This included tasks such as cleaning a large mess of agar in the microwave, which took at least 20 minutes. Although it was quite labor-intensive, we were very happy to do the work because we acquired a large amount of lab equipments we couldn’t have otherwise afforded.
December 10th - Gel electrophoresis day. Today we used our digested pAMP plasmids from lab 9 and checked our work through gel electrophoresis. The theoretical idea behind the process is detailed below, but for the practical idea we must go into how to prepare the test. Step 1: Prepare the Agarose gel: (whoever was in this group, please detail the process for the rest of us here)
Results of the Gel Electrophoresis:
 |
Explanation: The string of bands closest to the top of the picture is the DNA ladder, used as a ruler to measure the specific base pair length of the digested DNA. The 2 rows below are our digestion solutions, or pAMP plasmids that have been cleaved in 2 specific points by the restriction enzymes BamHI and HindIII. The fact that one row is split into two fragments means that the digestion for this particular Ampicillin resistance plasmid was successful, for the plasmid fragmented into 2 pieces of different sizes, therefore one will go further when the negative DNA is pushed through the gel by the negative charge. The row closest to the bottom of the picture however is an example of an unsuccessful digestion. For the plasmid remained intact and there is only one band. The gel has been removed and is being refrigerated for further use next time on the side while we're splitting into groups of three and doing lab 10 together |
|---|
'WINTER BREAK
January 14th - More brainstorming was done for the competition. We got down some more ideas. Someone brought up something about STD, but this idea got denied since there was no humane way to do the experiment. See Project Design.
January 18th - We decided who will go to the UCSD (Tareq, Gha Young, Brian, and Nicki). Spencer has planned the project for us; unfortunately, he could not come today to explain it. We will get it in the next meeting, which will be held on January 25th.
January 25th - Skype call with Spencer who detailed our project about promoters, activators and repressors. We studied the possibility of manipulating the position of the activator/repressor binding site so that repressors could possibly act as activators. We discussed the first step of the process which was to create a reporter plasmid so that we could measure the intensity of the expression, or in other words, measure the strength of promoter. We discussed three requirements of plasmids which were the origin site, the “part” gene, and the resistance marker. We then tackled the problem of isolating the promoter, which we decided to introduce a restriction enzyme site for restriction enzyme XBaI. This was so that introducing XBaI would split this restriction enzyme site in a palindromic fashion thus creating sticky ends. Then, we could introduce primers that we would design using ApE. This would allow the RNA polymerase to locate the primer and thus create a copy of a promoter. To create multiple copies of promoters, we would use PCR. By varying the distance of base pairs that the promoter sequence would have, the affinity that promoters would have for the RNA polymerase would vary and be measured by the visual prevalence of GFP gene expression.
January 28th - Meeting at Tareq’s House. Primer design; we discussed ApE, fixed members’ bugs, and looked at Mokhshan’s primer design. Also gave each team member responsibility of a job at every meeting.
Febuary 1st - We got a kick start in our inventory! (See Inventory) Spencer told us about the primer sequence we will be using for our project.
Febuary 4th - We got the PCR machine called Perkin Elmer Cetus 480 today. The machine has a program that consists of steps where we can input data in order to regulate a PCR in a certain way. It also asks for user number and file number. The user number used for simulation is 51. The numbers for the soak file, extension file, cycling file, and final extension file are 51,52,53, and 54, respectively.
| Soak File - #51 | Brings Temperature from Room to 98 degrees Celcius. |
|---|
| Extension File - #52 | Holds temperature at 98 degrees Celcius for 30 seconds so that the DNA Strands can temporarily separate from one another. |
|---|
PCR Cycler File - #53 |
|
|---|---|
| Segment 1 |
|
| Segment 2 |
|
| Segment 3 |
|
| Segment 4 |
|
| Segment 5 |
|
| Segment 6 |
|
| Number of Cycles |
|
| Final Extension File - #54 | |
|---|---|
| Segment 1 |
|
| Segment 2 |
|
| Segment 3 |
|
'''February 8th''' These were the primers that we plan to anneal to our plasmid during the PCR Process.
| Forward Primer Sequence: | GCTGATCTAGAGGATCTTAGCTACTAGAGAAAGAGGAGAAATACTAG |
|---|---|
| Reverse Primer Sequence: | TATACTCTAGAGAACCTGCCGTTTCTTGAGTTGC |
