"
Team:TPHS SanDiego/Log
From 2013hs.igem.org
Notebook
Daily Journal
October 4 - Tareq gave us an overview of the club and information about the iGEM competition. Meetings will be every Monday after school in Mr. Belyea’s room.
October 15 - Today was our first meeting. We went over the sterilizing procedure involving passing objects over a “fire” from a lighter. We also learned how to use a micropipettor.
October 22 - We prepared agar plates; half the plates with ampicillin mixed in and the other half without. The plates were labeled and put into the incubator.
October 29 - We discussed the procedure for inserting the plasmid pGREEN into the E coli.
November 2 - We completed the pGREEN lab today with the E coli. Results will be revealed on Monday.
November 5 - The results were unsatisfactory. None of the E coli. had absorbed the plasmid. The bioluminescence plasmid we had included did not cause it to glow green when we shined the ultraviolet light upon the plates. We will try again at the next meeting. Our weekly meetings have changed, and we will now meet twice a week, Monday and Friday. In addition, we looked at last year’s iGEM competition team wikis. We started to brainstorm some ideas for our project.
November 9 - Some new members came today. We taught them the basic procedures we had learned on the first day. Then, we repeated the pGREEN lab. This time we were more precise about the temperature of the heat shock and the timing of the tubes on ice. Hopefully this helps our success rate increase. Results will be revealed on Monday.
November 13 - The results are satisfactory. Two groups achieved the proper results with the pGREEN plasmid absorbed into the E coli. It glows green with the ultraviolet light. Afterwards, a letter to the parents was distributed to the team to take home. We went over the procedure for inserting two genes into a plasmid using restriction enzymes and DNA ligase. We will perform the lab at the next meeting.
November 16 - Meeting cancelled last minute due to our advisor being busy. Tareq informed us that there will be a mandatory parent’s meeting on Monday November 26th in the lecture hall at 6:30 PM.
November 26 - We carried out Lab 9, where we used restriction enzymes to cut plasmids in certain places. We were informed today that we have a mentor; Spencer Scott!
November 30- We met Spencer Scott, a UCSD graduate and our mentor, for the first time. Discussed possible feasibility of our proposed project. Digested and ligated pAMP and pKAN plasmids.
December 3rd- We proceeded with Lab 3, DNA restriction analysis. We cut Lambda DNA at 9 different sites with 2 different restriction enzymes, BamHI and HindIII (pronounced like Hind), and then used gel electrophoresis to check our work. With the help of our mentor Spencer, and his colleague John, we learned how to mix and cast 0.8% agarose gel, create wells in it, properly submerge the gel in a chamber full of electrophoresis buffer, and to fill the wells with minimal error/damage to the agarose gel. John delivered two lectures, one on the properties of how enzymes denature when heated and how that relates to hydrogen bonds, and the other on how restriction enzymes work, and how we will be using them throughout the iGEM competition. In the end we were not able to analyze the results of our gel electrophoresis due to time constraints; however, we now all know the basics of gel electrophoresis. John stressed the need for a laboratory notebook, so everyone will now bring a small notebook with them for lab notes. John told us, “In science you’re going to make a lot of mistakes, but it will be meaningless if you learn nothing from them.”
December 7th - In place of a lab, we devoted our attention to the theory behind the procedure. Spencer Scott and our supplementary mentor Dan lectured us about how synthetic biology is done. The basic premise of the lecture was to cover the entirety of the clone cycle, which consists of PCR (polymerase chain reaction) which will be detailed in the paragraph below, digestion (using restriction enzymes to fragment plasmids), ligation (using DNA ligase to join the digested fragments), transformation (making the E.coli take the plasmid), extraction from the E.coli itself then from the Agarose used in gel electrophoresis, and purification (isolating the specific gene that we need). PCR consists of multiple cycles of three basic steps: denaturation, annealing, extension. Denaturation unzips the DNA, annealing attaches the primers to the specific part of the genome that you want, primers are things that tell the DNA polymerase (the component that makes complementary sequences for the target DNA) where to begin. Extension, the process in which the DNA polymerase attaches and replicates the complementary sequence. Multiple cycles of PCR can eventually create billions of copies of the target DNA in question. Michael Margolis’ parents came and unloaded a large quantity of lab equipment for our use. We also spent some time cleaning the equipment as they were fairly unclean. This included tasks such as cleaning a large mess of agar in the microwave, which took at least 20 minutes. Although it was quite labor-intensive, we were very happy to do the work because we acquired a large amount of lab equipments we couldn’t have otherwise afforded.
December 10th - We performed gel electrophoresis. Using our digested pAMP plasmids, we checked our work from lab 9 through gel electrophoresis. The theoretical idea behind the process is detailed below, but for the practical idea we must go into how to prepare the test. Step 1: Prepare the Agarose gel:
Results of the Gel Electrophoresis:
 |
Explanation: The string of bands closest to the top of the picture is the DNA ladder, used as a ruler to measure the specific base pair length of the digested DNA. The 2 rows below are our digestion solutions, or pAMP plasmids that have been cleaved at 2 specific points by the restriction enzymes BamHI and HindIII. The fact that one row is split into two fragments means that the digestion for this particular Ampicillin resistance plasmid was successful, since the plasmid fragmented into 2 pieces of different sizes, therefore one will go further when the negative DNA is pushed through the gel by the negative charge. The row closest to the bottom of the picture, however, is an example of an unsuccessful digestion. The plasmid remained intact and only one band appeared. The gel was removed and was refrigerated for further use. |
|---|
'WINTER BREAK
January 14th - Brainstorming for the competition continued, and we came up with more ideas. See Project Design.
January 18th - We decided who will go to the UCSD (Tareq, Gha Young, Brian, and Nicki). Spencer has planned the project for us; unfortunately, he could not come today to explain it. We will get it in the next meeting, which will be held on January 25th.
January 25th - Skype call with Spencer who detailed our project about promoters, activators and repressors. We studied the possibility of manipulating the position of the activator/repressor binding site so that repressors could possibly act as activators. We discussed the first step of the process which was to create a reporter plasmid so that we could measure the intensity of the expression, or in other words, measure the strength of promoter. We discussed three requirements of plasmids which were the origin site, the “part” gene, and the resistance marker. We then tackled the problem of isolating the promoter, which we decided to introduce a restriction enzyme site for restriction enzyme XBaI. This was so that introducing XBaI would split this restriction enzyme site in a palindromic fashion thus creating sticky ends. Then, we could introduce primers that we would design using ApE. This would allow the RNA polymerase to locate the primer and thus create a copy of a promoter. To create multiple copies of promoters, we would use PCR. By varying the distance of base pairs that the promoter sequence would have, the affinity that promoters would have for the RNA polymerase would vary and be measured by the visual prevalence of GFP gene expression.
January 28th - Meeting at Tareq’s House. We discussed primer design, fixed members’ bugs concerning the program ApE, and looked over Mokhshan’s primer design. We also established responsibilities for each team member.
Febuary 1st - We took inventory. Spencer explained to us the primer sequence we will be using for our project.
Febuary 4th - We acquired the PCR machine, Perkin Elmer Cetus 480 today. The machine has a program that consists of steps where we can input data in order to regulate a PCR in a certain way. It also asks for user number and file number. The user number used for simulation is 51. The numbers for the soak file, extension file, cycling file, and final extension file are 51,52,53, and 54, respectively.
| Soak File - #51 | Brings Temperature from Room to 98 degrees Celcius. |
|---|
| Extension File - #52 | Holds temperature at 98 degrees Celcius for 30 seconds so that the DNA Strands can temporarily separate from one another. |
|---|
PCR Cycler File - #53 |
|
|---|---|
| Segment 1 |
|
| Segment 2 |
|
| Segment 3 |
|
| Segment 4 |
|
| Segment 5 |
|
| Segment 6 |
|
| Number of Cycles |
|
| Final Extension File - #54 | |
|---|---|
| Segment 1 |
|
| Segment 2 |
|
| Segment 3 |
|
February 8th- These were the primers that we plan to anneal to our plasmid during the PCR Process.
| Forward Primer Sequence: | GCTGATCTAGAGGATCTTAGCTACTAGAGAAAGAGGAGAAATACTAG |
|---|---|
| Reverse Primer Sequence: | TATACTCTAGAGAACCTGCCGTTTCTTGAGTTGC |
February 14th - We added the phusion DNA polymerase with it's buffer and ran the PCR with our primers. It was supposed to be run in 35 cycles; however, due to time constraints, It was ran in 30 cycles, which took about 1.5 hrs.
February 19th - Gel electrophoresis was done to test if the PCR worked.
To make your 0.8 % gel:
-Add 0.8 grams agarose to 100 ml TAE buffer
-Microwave until clear (1.5-2 min)
-Add 10 ul of gel red
-Insert well comb and let set
Add appropriate quantities of loading dye to samples and let set.
After the gel electrophoresis was run for 20 minutes, we shut off the lights and turned on the UV lights. Two distinctly separate bands of DNA were observed, indicating that PCR was successful.
February 20th - Video idea finalized for fundraising on indiegogo, we took a few panoramic shots of the lab for the video, and decided on how we should go about attracting donors on the site,
$0-10= donor list
$30= name on t-shirt
$50= name on footer of website
February 22nd - Tareq did the gel clean up during lunch, and we altogether did the PCR clean up after school. We did this using protocols given to us. Our mentor, Dan, also came today to help us out and answer our questions. He showed us a picture of fluorescent chromosomes. According to him, the colors (red,green,cyan,purple) should be distinctly adjacent so that indication of gene position can be easily done. In his example image, there was a great proportion of white color. The white color is caused by overlapping of multiple colors.
We worked on the Indiegogo site, figuring out how we are going to film the video and what perks will be available to the donors. We wrapped up the today’s meeting by running a denaturation process for XBaI restriction enzyme using the PCR machine at 65 deg Celsius.
February 25th - During lunch, Tareq streaked the DNA. After school, we took 100 microliters of competent cells and mixed them with 10 microliters of Luria Broth. We put the mixture into the thermocycler at 42 degrees celcius. Then, we did agar plates.
